View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10630_low_13 (Length: 232)
Name: NF10630_low_13
Description: NF10630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10630_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 54 - 215
Target Start/End: Complemental strand, 22762962 - 22762801
Alignment:
| Q |
54 |
attaagttcttattgtagagaaggaaaaatcactgtattaagggtgaattggactagctatcgatagacagtaaaccagtataaatatattgtgtcattc |
153 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22762962 |
attaagttcttattgtagagaaggcaaaatcactgtattaagggtggattggactagctatcgatagacagtgaaccagtataaatatattgtgtcattc |
22762863 |
T |
 |
| Q |
154 |
tttcgggacaagatcataacgaggttcgcttcccccattgggtttataagctcccctgatgt |
215 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22762862 |
tttcaggacaagatcataacgagtttcgcttcccccattgggtttataagctcccccgatgt |
22762801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 22762938 - 22762885
Alignment:
| Q |
1 |
caaaatcactgtattaagggtggattggactagctatcaatagacagtgaacca |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22762938 |
caaaatcactgtattaagggtggattggactagctatcgatagacagtgaacca |
22762885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University