View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10630_low_14 (Length: 229)
Name: NF10630_low_14
Description: NF10630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10630_low_14 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 16 - 229
Target Start/End: Complemental strand, 34879794 - 34879581
Alignment:
| Q |
16 |
aagattgtaatagtactagttcccattggccttattcttgatggattcaaatctaggacccttatcaccaaacttagtttttccataaagctccaaatag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34879794 |
aagattgtaatagtactagttcccattggccttattcttgatggattcaaatctaggacccttatcaccaaacttagtttttccataaagctccaaatag |
34879695 |
T |
 |
| Q |
116 |
tcaccatagcagtaattacttggatacaagagtttaggagctggagaaataatagcttcaccaactggattatagaaacttgcaatagatagtctacttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34879694 |
tcaccatagcagtaattacttggatacaagagtttaggagctggagaaataatagcttcaccaactggattatagaaacttgcaatagatagtctacttc |
34879595 |
T |
 |
| Q |
216 |
cattcttgtcaggc |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34879594 |
cattcttgtcaggc |
34879581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University