View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10630_low_15 (Length: 215)
Name: NF10630_low_15
Description: NF10630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10630_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 19 - 201
Target Start/End: Complemental strand, 29598440 - 29598258
Alignment:
| Q |
19 |
tttttactaatggcatgtttgtttgtacgttggtaagagagtagacttgcgtttattgagaagcccaaatactagcttcagaatatcacgttgaattttg |
118 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||| ||||| |||||||||||||||||| |||||||| ||||| ||||||||||||||||||| |
|
|
| T |
29598440 |
tttttacccatggcatgtttgtttgtaagttggtaagagaatagacgtgcgtttattgagaagcctaaatactatcttcacaatatcacgttgaattttg |
29598341 |
T |
|
| Q |
119 |
tctccggacgcgaaaatcgtgcctctactgcatatccaaacagaggctaagtcttttgagtggggataagttgcagttcttct |
201 |
Q |
| |
|
||| ||| || |||||| |||||| | |||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29598340 |
cctcgggatgcaaaaatcatgcctccagtgcacatccaaacagaggctaagtcttttgagtggggataagtggcagttcttct |
29598258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 160
Target Start/End: Complemental strand, 29527800 - 29527660
Alignment:
| Q |
24 |
actaatggcatgtttgtttgtacgttggtaagaga---gtagacttgcgtttattgagaagcc-caaatactagcttcagaatatcacgttgaattttgt |
119 |
Q |
| |
|
|||||||| ||||||||||| |||||| ||||| ||||||| ||||||| | ||||||| |||||| |||||||| ||||||||||| | ||| |
|
|
| T |
29527800 |
actaatggtctgtttgtttgtgcgttggcgagagactagtagactagcgtttactaagaagccacaaatattagcttcacaatatcacgttcacattttc |
29527701 |
T |
|
| Q |
120 |
ctccggacgcgaaaatcgtgcctctactgcatatccaaaca |
160 |
Q |
| |
|
|| |||| |||||||| |||||| || ||| ||||||||| |
|
|
| T |
29527700 |
cttgggacacgaaaatcatgcctccaccgcacatccaaaca |
29527660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 34 - 134
Target Start/End: Complemental strand, 27912904 - 27912803
Alignment:
| Q |
34 |
tgtttgtttgtacgttggtaagagagtagacttgcgtttattgagaagcc-caaatactagcttcagaatatcacgttgaattttgtctccggacgcgaa |
132 |
Q |
| |
|
||||||||||| |||||| || |||| || || ||||||||||||||| ||||||||||||||| |||||||||| | ||||| ||| |||||||| |
|
|
| T |
27912904 |
tgtttgtttgtgcgttggggggaaagtaaacgtgtgtttattgagaagccacaaatactagcttcacaatatcacgtccacttttgcctcatgacgcgaa |
27912805 |
T |
|
| Q |
133 |
aa |
134 |
Q |
| |
|
|| |
|
|
| T |
27912804 |
aa |
27912803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 143
Target Start/End: Original strand, 29555575 - 29555633
Alignment:
| Q |
85 |
aaatactagcttcagaatatcacgttgaattttgtctccggacgcgaaaatcgtgcctc |
143 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || || ||||||||||||| |||||| |
|
|
| T |
29555575 |
aaatactagcttcacaatatcacgttgaatcctgcttcgggacgcgaaaatcttgcctc |
29555633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University