View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10630_low_16 (Length: 208)
Name: NF10630_low_16
Description: NF10630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10630_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 14 - 186
Target Start/End: Complemental strand, 43128911 - 43128738
Alignment:
| Q |
14 |
caaaggaaaattggttagtgaaaacaattaaactttcacta-agcatagtaaaaactttcatccaaaagacctaacagagcaatttgttgtctacatgtc |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| | ||| ||||||||||||||| ||||||||||| || |||||||||||||||||||| |
|
|
| T |
43128911 |
caaaggagaattggttagtgaaaacaattaaactttcactacaacatcgtaaaaactttcatcaaaaagacctaaaagcacaatttgttgtctacatgtc |
43128812 |
T |
|
| Q |
113 |
ttctaggtataatttacttcgtgatagttatattagttcaacaactaagattgtgttgaagaggatgtgagggg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43128811 |
ttctaggtataatttacttcgtgatagttatattagttcaacaactaagattgtgttgaagaggatatgagggg |
43128738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University