View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10630_low_6 (Length: 311)
Name: NF10630_low_6
Description: NF10630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10630_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 18 - 290
Target Start/End: Complemental strand, 41548646 - 41548369
Alignment:
| Q |
18 |
ttttatcaataggaaccgaac--gatattc---gagtttacaacagtcacacacttggctccatgcaagagtgtgttcctttaagatctgggaacataaa |
112 |
Q |
| |
|
||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
41548646 |
ttttatcaataggaaccgaactcgatatcccaagagtttacaacagtcacacacttggctccatgcaagagtgtgttcctctaagatctgggaacataga |
41548547 |
T |
|
| Q |
113 |
tgccaacatagccaacccccacaacaaagaaggcaatagattgcaggaaaagatatatatagcactgattcttcccaaaggcaagatcgtagcatccaca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41548546 |
tgccaacatagccaacccccacaacaaagaaggcaatagattgcaggaaaagatatatatagcactgattcttcccaaaggcaagatcgtagcatccaca |
41548447 |
T |
|
| Q |
213 |
caaaaagagataggctcccacaccaagttctaggaaatgaatcctgttttaacatcaacaaacaagtagaaaagtgag |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41548446 |
caaaaagagataggctcccacaccaagttctaggaaatgaatcctgttttaacatcaacaaacaagtagaaaagtgag |
41548369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University