View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10631_high_1 (Length: 463)
Name: NF10631_high_1
Description: NF10631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10631_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 1e-66; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 15 - 159
Target Start/End: Complemental strand, 20227416 - 20227272
Alignment:
| Q |
15 |
atcatgtataatatcaaccactgattttcataatttaccaactactcactttagttgagttaaatccccaaataaaatatgggtgtggtttatttattta |
114 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20227416 |
atcatgtataatattaaccattgattttcataatttaccaactactcactttagtagagttaaatccccaaataaaatatgggtttggtttatttattta |
20227317 |
T |
 |
| Q |
115 |
atttttgacaatgggtgtgttttcataaacatctacatttgcata |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20227316 |
atttttgacaatgggtgtgttttcataaacatctacatttgcata |
20227272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 417 - 458
Target Start/End: Complemental strand, 20227202 - 20227161
Alignment:
| Q |
417 |
attgagaatggtgtctttccattattcagagcctatgcttct |
458 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20227202 |
attgagaatggtgtctttccattattcagagcctatgtttct |
20227161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 391 - 421
Target Start/End: Complemental strand, 20227254 - 20227224
Alignment:
| Q |
391 |
tggttttcataaggtgtacttataacattga |
421 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20227254 |
tggttttcataaggtgtacttataacattga |
20227224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University