View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10631_low_13 (Length: 240)
Name: NF10631_low_13
Description: NF10631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10631_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 14 - 223
Target Start/End: Original strand, 7326525 - 7326735
Alignment:
| Q |
14 |
cccttattaatcactcattttcctattttataggatgcaaattattacaaaaaaccaatacg-taaaagatgtactccaataagtacaactcatatggta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7326525 |
cccttattaatcactcattttcctattttataggatgcaaagtattacaaaaaaccaatacggtaaaagatgtactccaatgagtacaactcatatggta |
7326624 |
T |
 |
| Q |
113 |
aaaggttgcatggacatttgatatgttagtgcgaatttgaacttgcatttctccactacttagcagtgtgtgtgagtttcgccactaaactatttaaaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7326625 |
aaaggttgcatggacatttgatatgttattgcgaatttgaacttgcatttctccactacttagcagtgtgtgtgagtttcgccactaaactatttaaaat |
7326724 |
T |
 |
| Q |
213 |
aaaattagact |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
7326725 |
aaaattagact |
7326735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 93 - 141
Target Start/End: Complemental strand, 13475501 - 13475453
Alignment:
| Q |
93 |
taagtacaactcatatggtaaaaggttgcatggacatttgatatgttag |
141 |
Q |
| |
|
|||||| |||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
13475501 |
taagtataactcagatggtaaaaggttgcaaagacatttgatatgttag |
13475453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 95 - 137
Target Start/End: Complemental strand, 5122754 - 5122712
Alignment:
| Q |
95 |
agtacaactcatatggtaaaaggttgcatggacatttgatatg |
137 |
Q |
| |
|
||||||||||||||| |||||||||| | |||||||||||||| |
|
|
| T |
5122754 |
agtacaactcatatgttaaaaggttgtagggacatttgatatg |
5122712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 93 - 139
Target Start/End: Complemental strand, 40094734 - 40094688
Alignment:
| Q |
93 |
taagtacaactcatatggtaaaaggttgcatggacatttgatatgtt |
139 |
Q |
| |
|
||||||||||||| ||||||||| ||||| |||||||||||||||| |
|
|
| T |
40094734 |
taagtacaactcagatggtaaaattttgcagggacatttgatatgtt |
40094688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 93 - 141
Target Start/End: Complemental strand, 40082480 - 40082432
Alignment:
| Q |
93 |
taagtacaactcatatggtaaaaggttgcatggacatttgatatgttag |
141 |
Q |
| |
|
||||||||||||||||||||||||| || | |||||||||||||||| |
|
|
| T |
40082480 |
taagtacaactcatatggtaaaaggatgtgggaacatttgatatgttag |
40082432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 93 - 139
Target Start/End: Complemental strand, 39535521 - 39535475
Alignment:
| Q |
93 |
taagtacaactcatatggtaaaaggttgcatggacatttgatatgtt |
139 |
Q |
| |
|
||||||||||||| ||||||||| |||||||| | |||||||||||| |
|
|
| T |
39535521 |
taagtacaactcaaatggtaaaatgttgcatgaatatttgatatgtt |
39535475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University