View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10631_low_17 (Length: 228)
Name: NF10631_low_17
Description: NF10631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10631_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 211
Target Start/End: Original strand, 42103718 - 42103910
Alignment:
| Q |
19 |
caataatctgctacccgccaaagtactgtatcatttcatcgtcgcccatacccatgaaatcatctaaaaggaatggcggtgatggtggattgtcaagaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42103718 |
caataatctgctacccgccaaagtactgtatcatttcatcgtcacccatacccatgaaatcatctaaaaggaatggcggtgatggtggattgtcaagaac |
42103817 |
T |
|
| Q |
119 |
tccaaaatcaaatgacatgttagtaattggtgatccaaacctatccagctcgttttggaatgcgtctttagcgaaataatttatgtctcctcc |
211 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42103818 |
tccaaaatcaaatgacatgttagtgattggtgatccaaacctatccagctcgttttggaatgcgtctttagcgaaataatttatgtctcctcc |
42103910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 19 - 211
Target Start/End: Original strand, 42112908 - 42113100
Alignment:
| Q |
19 |
caataatctgctacccgccaaagtactgtatcatttcatcgtcgcccatacccatgaaatcatctaaaaggaatggcggtgatggtggattgtcaagaac |
118 |
Q |
| |
|
||||||||| ||| | ||||||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42112908 |
caataatcttctatgctccaaagtactgcatcatttcatcgtcacccaaacccatgaaatcatctaaaaggaatggcggtgatggtggattgtcaagaac |
42113007 |
T |
|
| Q |
119 |
tccaaaatcaaatgacatgttagtaattggtgatccaaacctatccagctcgttttggaatgcgtctttagcgaaataatttatgtctcctcc |
211 |
Q |
| |
|
|||||||||||||||||||||| | | ||||||||||||||||||||||||||| |||||| ||||||||| | |||||| ||| ||||||| |
|
|
| T |
42113008 |
tccaaaatcaaatgacatgttactcaacggtgatccaaacctatccagctcgtttgggaatgtgtctttagcaatataattcatgcctcctcc |
42113100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University