View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10631_low_20 (Length: 209)
Name: NF10631_low_20
Description: NF10631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10631_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 14 - 191
Target Start/End: Complemental strand, 3977248 - 3977072
Alignment:
| Q |
14 |
caaagggcctggaacatataagtagatttctatgtagtagcattaatactttaaattgaaggcgtgtctgatatcagatatgtatcattgtctgactcta |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3977248 |
caaaaggcctggaacatataagtagatttctatgtagtagcattaatactttaaattgaaggcgtgtctgatatcagatatgtatcactgtctgactcta |
3977149 |
T |
|
| Q |
114 |
acatgacatatatgtatgtggttatattcaattagttccatttttcgcaaactattaccggtgtctacatgacactag |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3977148 |
acatgacatatatgtatgtggttatattcaattagttcca-ttttcgcaaactattaccggtgtctacatgacactag |
3977072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University