View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10633_low_4 (Length: 251)
Name: NF10633_low_4
Description: NF10633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10633_low_4 |
 | |
|
| [»] scaffold0262 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 46 - 237
Target Start/End: Complemental strand, 33441735 - 33441544
Alignment:
| Q |
46 |
tagttattactaataattagcccccttcattattatttatttagtttgtttacattggtgaatgtaatatcattttgttatttatgattaataaaagcca |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33441735 |
tagttattactaataattagcccccttcattattatttatttagtttgtttacattggtgaatgtaatatcattttgttatttatgattaataaaaccca |
33441636 |
T |
|
| Q |
146 |
tgagaggcattgagattatttgctgatggataatatgtcagttcatcctactctgaaattgtttatatggtgaaaccatatacaatgaattg |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33441635 |
tgagaggcattgagattatttgctgatggataatatgtcacttcaacttactctgaaattgtttatatggtgaaaccatatacaatgaattg |
33441544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 46 - 210
Target Start/End: Complemental strand, 33451955 - 33451791
Alignment:
| Q |
46 |
tagttattactaataattagcccccttcattattatttatttagtttgtttacattggtgaatgtaatatcattttgttatttatgattaataaaagcca |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33451955 |
tagttattactaataattagcccccttcattattatttatttagtttgtttacattggtgaatgtaatatcattttgttatttatgattaataaaaccca |
33451856 |
T |
|
| Q |
146 |
tgagaggcattgagattatttgctgatggataatatgtcagttcatcctactctgaaattgttta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
33451855 |
tgagaggcattgagattatttgctgatggataatatgtcagttcaacttactctgaaattgttta |
33451791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0262 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 136 - 234
Target Start/End: Original strand, 1400 - 1496
Alignment:
| Q |
136 |
ataaaagccatgagaggcattgagattatttgctgatggataatatgtcagttcatcctactctgaaattgtttatatggtgaaaccatatacaatgaa |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
1400 |
ataaaagccatgagaggcattgagattatttgctgagggataatatgtcagtttatcctac-ctg-aattgcttatatggtgaaaccatatacaatgaa |
1496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University