View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10633_low_5 (Length: 241)
Name: NF10633_low_5
Description: NF10633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10633_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 114 - 223
Target Start/End: Original strand, 34465400 - 34465509
Alignment:
| Q |
114 |
ttccattttcctccatctcttcatcttcaccaccacaaacaccattcttcccatcttactattcaccaccactccctccttctccacctttcctcgccac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34465400 |
ttccattttcctccatctcttcatcttcaccaccacaaacaccattcttcccatcttactattcaccaccactccctccttctccacctttcctcgccac |
34465499 |
T |
|
| Q |
214 |
tttcccagcc |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
34465500 |
tttcccagcc |
34465509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 34465287 - 34465332
Alignment:
| Q |
1 |
ccgccgtatcctccaccaaccactgtcgtttccttctatctctctt |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34465287 |
ccgccgtatcctccaccaaccactgtcgtttccttctatctctctt |
34465332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University