View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10634_low_2 (Length: 310)
Name: NF10634_low_2
Description: NF10634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10634_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 294
Target Start/End: Original strand, 31820432 - 31820704
Alignment:
| Q |
18 |
tattcaaagtttaaatctgtaacacagtatatagattaataaatttagttaatttttctttagaagaattgattaaaactctatttttacgattccgttg |
117 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31820432 |
tattcaaagtttaaatctgtaacatagcatatagattaataaatttagttaatttt-----agaagaatcgattaaaactctatttttacgattccgttg |
31820526 |
T |
|
| Q |
118 |
tgagacacactcatttcttttgacaaaaaagaggtagatgtagtagaacttttgtgatttgtgtcggtgatgtaatgtgctcaaaattagtgtgtttagg |
217 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31820527 |
tgagacacactctttttttttgacaaaaaagaggtagatgtagtagaacttttgtgatttgtgtcggagatgtaatgtgctcaaaattagtgtgtttagg |
31820626 |
T |
|
| Q |
218 |
gtttaagtctgaatgagtaacttaag-ttttctttttggtctcactattgacggaaatcaacgtgaaactttgatgtc |
294 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31820627 |
gtttaagtctaaatgagtaacttaagtttttttttttggtctcactattgacggaaatcaacgtgaaactttggtgtc |
31820704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University