View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10635_low_6 (Length: 223)
Name: NF10635_low_6
Description: NF10635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10635_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 30 - 207
Target Start/End: Complemental strand, 2927484 - 2927307
Alignment:
| Q |
30 |
gcctactagttaacatttgaagaatcatggttgcatcttaagatttcagattctttgattttcattcaaggagaaatggaaagattggtggcgagtttgt |
129 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2927484 |
gcctactaattaacatttgaagaatcatggttgcatcttaagatttcagattctttgattttcattcaaggagaaatggaaagattggtggcgagtttgt |
2927385 |
T |
|
| Q |
130 |
tgaaatcacattactcattgtgattttggcaatatatacactttggagcttcaacaaaacacagtgctaccgtgattt |
207 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2927384 |
tgaaatcacattactcactgtgattttggcaatatatacactttggagcttcaacaaaacacagtgctaccgtgattt |
2927307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 31 - 164
Target Start/End: Original strand, 2311904 - 2312036
Alignment:
| Q |
31 |
cctactagttaacatttgaagaatcatggttgcatcttaagatttcagattctttgattttcattcaaggagaaatggaaagattggtggcgagtttgtt |
130 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||| || ||| |||||||||||||||| ||||||||||||||||||||| || ||| || |||| | |
|
|
| T |
2311904 |
cctactaattaacatttgaagaatcaaggttgcatctcaaaatt-cagattctttgatttttattcaaggagaaatggaaagactgatggtgaatttgat |
2312002 |
T |
|
| Q |
131 |
gaaatcacattactcattgtgattttggcaatat |
164 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||| |
|
|
| T |
2312003 |
gaaatcacactactcactgtgattttggcaatat |
2312036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 38692801 - 38692845
Alignment:
| Q |
166 |
tacactttggagcttcaacaaaa-cacagtgctaccgtgattttg |
209 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||| ||||| |
|
|
| T |
38692801 |
tacactttggagcttcaacaaaatcacagtgccaccgtggttttg |
38692845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University