View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10636_high_6 (Length: 252)
Name: NF10636_high_6
Description: NF10636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10636_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 48616791 - 48616536
Alignment:
| Q |
1 |
tcagctaatttttaacttattattaaatcaaggaaaacgttgtttatagcgaaaagaaattcgcataatttcatgttcccgatgcctt--------ttct |
92 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48616791 |
tcagctaatttttaacatattattaaatcaaggaaaacgttgtttatagtgaaaagaaattcgcataatttcatgttcccgatgccttcgcgagatttct |
48616692 |
T |
 |
| Q |
93 |
ctcactatatatatagtc----tagcatgacttattctccatattacatggaaaaatttgccttgtcccggctttgaactctctaccttgaatcgcctga |
188 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
48616691 |
ctcactatatatatagtcagtctagcatgactaattctccatattacatgggaaaatttgccttgtcccagctttgaactctctaccttgaatcg-ctga |
48616593 |
T |
 |
| Q |
189 |
catttgatctactccccagacgaacaaattgattggcctctttttaaccctttgctt |
245 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48616592 |
catttgatctactcaccagacgaacaaatcgattggcctctttttaaccctttgctt |
48616536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University