View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10636_high_7 (Length: 250)
Name: NF10636_high_7
Description: NF10636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10636_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 50 - 234
Target Start/End: Complemental strand, 53941827 - 53941641
Alignment:
| Q |
50 |
gagcagctacatttccatggctcaaagnnnnnnnn--gggaaaatgggatacgcaaacatcatatcaaagtaagattgattatttaaaaggttgtgggag |
147 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53941827 |
gagcagctacatttccatggctcaaagaaaaaaaaaagggaaaatgggatacgcaaacatcatatcaaagtaagattgattatttaaaaggttgtgggaa |
53941728 |
T |
 |
| Q |
148 |
ctatgaaccacattatgtgaatcaccttgaaacttcacctccgaaaacctcatatctatagaaaacataattgccaacctttctttt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53941727 |
ctatgaaccacattatgtgaatcaccttgaaacttcacctccgaaaacctcatatctttagaaaacataattgccaacctttctttt |
53941641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 205
Target Start/End: Complemental strand, 55446192 - 55446095
Alignment:
| Q |
108 |
catatcaaagtaagattgattatttaaaaggttgtgggagctatgaaccacattatgtgaatcaccttgaaacttcacctccgaaaacctcatatcta |
205 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||| | | | |||||||||| | || ||||||| |||| |||||| |||||| |||||||| |
|
|
| T |
55446192 |
cataccaaagtaagattgattatttgaaaggttgtgaaaacgacgaaccacatttagggagtcaccttcaaacatcacctagaaaaaccccatatcta |
55446095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University