View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10636_low_13 (Length: 242)
Name: NF10636_low_13
Description: NF10636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10636_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 42751756 - 42751531
Alignment:
| Q |
1 |
cattcttctttgttgctaacagcacaattagagaaagcttatttgtatgatgctaactttttccagtaatcggtgcttgcttcgtgctgcaaagccatgg |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42751756 |
cattcttctttgttgctaacaacacaattagagaaagcttatttgtatgatgctaactttttccagtaatcggtgcttgcttcgtgctgcaaagccatgg |
42751657 |
T |
|
| Q |
101 |
cctagcagccctgacagacgcttcttttctgtaactgagagtttgtgtaattgttgnnnnnnngtttattctacgtcttctttgtcttcaatcacttttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42751656 |
cctagcagccctgacagacgcttcttttctgtaactgagagtttgtgtaattgttgtttttttgtttattctacgtcttctttgtcttcaatcacttttc |
42751557 |
T |
|
| Q |
201 |
tgctacttgaaaagatgattcttttg |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42751556 |
tgctacttgaaaagatgattcttttg |
42751531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University