View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10636_low_14 (Length: 242)
Name: NF10636_low_14
Description: NF10636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10636_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 101 - 224
Target Start/End: Original strand, 41009116 - 41009239
Alignment:
| Q |
101 |
aatggaaaaatatgtgcttgctttgaaattggtgtcacatggtgatggcagggtctgagcagaaaactggtccatatattatcaggattgctttttctgg |
200 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41009116 |
aatggaaaaatctgtgcttgcttcgaaattggtgtcacatggtgatggcagggtctgagcagaaaactggtccatatattatcaggattgctttttctgg |
41009215 |
T |
|
| Q |
201 |
tttcatggccaattttcaggtact |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41009216 |
tttcatggccaattttcaggtact |
41009239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University