View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10636_low_16 (Length: 239)
Name: NF10636_low_16
Description: NF10636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10636_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 38 - 198
Target Start/End: Complemental strand, 31008658 - 31008494
Alignment:
| Q |
38 |
aatatcaagctcgaagctaaatcgtctcatgttgattaaatgtttacattgtctaaattatgtgaatgggtggaagaccaattgcatgta----actagc |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31008658 |
aatatcaagctcgaagctaaatcgtctcatgttgattaaaagtttacattgtctaaaatatgtgaatgggtggaagaccaattgcatgtaactaactagc |
31008559 |
T |
|
| Q |
134 |
ctgatagtttctcctacaagatgtaagcaatgacatatcaatcgactgaacattcaaatttagac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| ||||||| || ||||||||| |
|
|
| T |
31008558 |
ctgatagtttctcctacaagatgtaagcaatgacatctcaatcgcctgaacagtcgaatttagac |
31008494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University