View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10636_low_17 (Length: 239)
Name: NF10636_low_17
Description: NF10636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10636_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 39293899 - 39294105
Alignment:
| Q |
1 |
gtctgtcgatgagtaagggaaacgataggcacaatggtttgatcattccaaagacaaagaatgccactgccacagatactgttcggtcatcatctttttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
39293899 |
gtctgtcgatgagtaagggaaacgataggcacaatggtttgatcattccaaagacaaagaatgcc------acagatactgttcggttatcatctttttc |
39293992 |
T |
 |
| Q |
101 |
ctttcagttaatttcggcttgcatctgttcggctgatcctctttagagtacctccagggtgtctcataatcagcaaggaacgtaactttgaacatctttg |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39293993 |
ctttcagttaatttcggcttgcatgtgttcggctgatcctctttagagcacctccagggtgtctcataatcagcaaggaacgtaactttgaacatctttg |
39294092 |
T |
 |
| Q |
201 |
agcatgaaataac |
213 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
39294093 |
agcatgtaataac |
39294105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University