View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10636_low_18 (Length: 238)
Name: NF10636_low_18
Description: NF10636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10636_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 12 - 73
Target Start/End: Original strand, 43293978 - 43294039
Alignment:
| Q |
12 |
agcagagacaatgttgtcaacacttgattttatgttattgaaatttgagctataagtatgta |
73 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43293978 |
agcaaagacaatgttgtcaacacttgattttatattattgaaatttgagctataagtatgta |
43294039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 129 - 220
Target Start/End: Original strand, 43294038 - 43294119
Alignment:
| Q |
129 |
tacaatgtagtagtagctagctaagacattatcaataactcccagaaagttgcatttaatatagccttgtagatcacaatttgctatctctt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43294038 |
tacaatgtagtagtagctagctaagacaatatca----------gaaagttgcatttaatatagccttgtagatcacaatttgctatctctt |
43294119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University