View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10636_low_21 (Length: 225)
Name: NF10636_low_21
Description: NF10636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10636_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 206
Target Start/End: Complemental strand, 5995391 - 5995194
Alignment:
| Q |
9 |
agaagcagagaagaaaagttttggttctgttttcaatagtttttataagcttgaaagtgaatattatgatcattacaagaaagttatgggaactaaaagt |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5995391 |
agaatcagagaagaaaagttttggttctgttttcaatagtttttataagcttgaaagtgaatattatgatcattacaagaaagttatgggaactaaaagt |
5995292 |
T |
|
| Q |
109 |
tggggacttggacctgtttctttatgggctaatcaagatgattcagataaagctgcaagagggtatgcaaagaaagaagaaggtgcaaaagaagaagg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5995291 |
tggggacttggacctgtttctttatgggctaatcaagatgattcagataaagctgcaagagggtatgcaaggaaagaagaaggtgcaaaagaagaagg |
5995194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University