View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10636_low_23 (Length: 209)
Name: NF10636_low_23
Description: NF10636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10636_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 16 - 192
Target Start/End: Complemental strand, 36904880 - 36904715
Alignment:
| Q |
16 |
aaggatccctggtttcagattgaccacacctaaagcccatgttcttcgcatatcttcaaatgaactaaaatggaactcaaagaaaccctttcccagaagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
36904880 |
aaggatccctggtttcagattgaccacacctaaagcccatgttcttcgcatatcttcaaatgaact-----------caaagaaaccctttcccagaggt |
36904792 |
T |
|
| Q |
116 |
gtaatgtaccaattacgcaaagagggccacaacatagatagcttctgttgcaaagttaaggttgtcaaaggttgatc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36904791 |
gtaatgtaccaattacgcaaagagggccacaacatagatagcttctgttgcaaagttaaggttgtcaaaggttgatc |
36904715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 14 - 192
Target Start/End: Original strand, 28105118 - 28105296
Alignment:
| Q |
14 |
caaaggatccctggtttcagattgaccacacctaaagcccatgttcttcgcatatcttcaaatgaactaaaatggaactcaaagaaaccctttcccagaa |
113 |
Q |
| |
|
||||| ||||||||||||| |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28105118 |
caaagaatccctggtttcaaattgaccacacccaaagcccaagttcttcgcatatcttcaaatgaactaaaatggaactcaaagaaaccctttcccaaag |
28105217 |
T |
|
| Q |
114 |
gtgtaatgtaccaattacgcaaagagggccacaacatagatagcttctgttgcaaagttaaggttgtcaaaggttgatc |
192 |
Q |
| |
|
||||||||| ||||||||||||| ||||| ||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28105218 |
gtgtaatgttccaattacgcaaatagggctgcaaaatagacagcttctgttgcaaagctaaggttgtcaaaggttgatc |
28105296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University