View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10637_high_2 (Length: 358)
Name: NF10637_high_2
Description: NF10637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10637_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 343
Target Start/End: Original strand, 5952299 - 5952638
Alignment:
| Q |
1 |
ccaaggaccttatcaatggctttatacactattttcattgccccttttccaagaatacctccaacctgtcaacatgtcagtgtcatattcggtgtttgcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5952299 |
ccaaggaccttatcaatggctttatacactattttcattgccccttttccaagaatacctccaacctgtccacatgtcagtgtcatattcggtgtttgcc |
5952398 |
T |
 |
| Q |
101 |
tcggtgcttcatggctcacgagcgcctcacaaaaatgttaaaaattgtatcccattatgattcaaaatctatgtagcaccgacacttcttctgatttaaa |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5952399 |
tcggtgcttcatagctcacgagcgcctcacaaaaatgttaaaaattgtatctcattctgactcaaaatctatgtagcaccgaca---cttctgatttaaa |
5952495 |
T |
 |
| Q |
201 |
ggtgtgtccattgtttgacatgtgtaggtgccagacactgacacgacaccaacacacatgtgtacattcaaatcattcatttactaaaattatcatcaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5952496 |
ggtgtgtccattgtttgacatgtgtaggtgccagacactgacacgacaccgacacacatgtgtacattcaaatcattcatttactaaaattatcatcaat |
5952595 |
T |
 |
| Q |
301 |
aatctaacgtgtcagtaccaatgtcgtgtctaccgttcatatt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5952596 |
aatctaacgtgtcagtaccaatgtcgtgtctactgttcatatt |
5952638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 12 - 67
Target Start/End: Complemental strand, 28188230 - 28188175
Alignment:
| Q |
12 |
atcaatggctttatacactattttcattgccccttttccaagaatacctccaacct |
67 |
Q |
| |
|
|||||| |||||||||| | ||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
28188230 |
atcaattgctttatacaatgttttcttttccccttttccaagaatagctccaacct |
28188175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University