View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10637_high_5 (Length: 251)

Name: NF10637_high_5
Description: NF10637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10637_high_5
NF10637_high_5
[»] chr8 (1 HSPs)
chr8 (1-201)||(39079676-39079866)


Alignment Details
Target: chr8 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 39079676 - 39079866
Alignment:
1 ttataacaaaagttaaattcacagagaggtaaatcaatctcttatcgaccgagctaaccttcattactcttgagatgcacttatatcttgttgcgtctaa 100  Q
    |||||||| |||||||||||||| | || ||||||||||||||||||||||||||| |||||||||||  | |     | |||||||||||||| |||||    
39079676 ttataacagaagttaaattcacaaacagataaatcaatctcttatcgaccgagctagccttcattacttataa-----agttatatcttgttgcatctaa 39079770  T
101 aaatcacaaaagtataatatgataaaaagagnnnnnnnnnnngtctttctctcaagttatgggtggtcttaaatttatttagaatactacaattttcgat 200  Q
    |||||||||||||||||||||||||||||||           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
39079771 aaatcacaaaagtataatatgataaaaagagaaaaaa-----gtctttctctcaagttatgggtggtcttaaatttgtttagaatactacaattttcgat 39079865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University