View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10637_low_16 (Length: 251)
Name: NF10637_low_16
Description: NF10637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10637_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 39079676 - 39079866
Alignment:
| Q |
1 |
ttataacaaaagttaaattcacagagaggtaaatcaatctcttatcgaccgagctaaccttcattactcttgagatgcacttatatcttgttgcgtctaa |
100 |
Q |
| |
|
|||||||| |||||||||||||| | || ||||||||||||||||||||||||||| ||||||||||| | | | |||||||||||||| ||||| |
|
|
| T |
39079676 |
ttataacagaagttaaattcacaaacagataaatcaatctcttatcgaccgagctagccttcattacttataa-----agttatatcttgttgcatctaa |
39079770 |
T |
 |
| Q |
101 |
aaatcacaaaagtataatatgataaaaagagnnnnnnnnnnngtctttctctcaagttatgggtggtcttaaatttatttagaatactacaattttcgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39079771 |
aaatcacaaaagtataatatgataaaaagagaaaaaa-----gtctttctctcaagttatgggtggtcttaaatttgtttagaatactacaattttcgat |
39079865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University