View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10637_low_20 (Length: 238)
Name: NF10637_low_20
Description: NF10637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10637_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 39079539 - 39079321
Alignment:
| Q |
1 |
cggcaatatcctcaactgagaaaatgttattattcaaatcgacataaccaataaatctattggttaagtgactatggtttatgttcaatnnnnnnnntgt |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
39079539 |
cggcaatatcctcaactaagaaaatgttattattcaaatcgacataaccaataaatctagtggttaagtgactatggtttatgttcaat-aaaaaaatgt |
39079441 |
T |
|
| Q |
101 |
ggttgctaaccttgttatagcaccggacaactcaaacc---tgaaattcttccggttcatcccaggtttgagtttgaatggtccaaatatggtttgaact |
197 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
39079440 |
ggttgctaaccttgttatagcactggacaactcaaacctgatgaaattcttccggttcatcccag------gtttgaatggtccaaatagggtttgaact |
39079347 |
T |
|
| Q |
198 |
gcaccaatgatgcttccctaaaagaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39079346 |
gcaccaatgatgcttccctaaaagaa |
39079321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University