View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10638_low_13 (Length: 309)
Name: NF10638_low_13
Description: NF10638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10638_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 11 - 295
Target Start/End: Original strand, 11849178 - 11849456
Alignment:
| Q |
11 |
cagagaccttggaaccaagtcttcaactagctgcagcagtgctttctgaggtaactatcataatgttattggaacaaatatattgacctaatggaaaaac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
11849178 |
cagagaccttggaaccaagtcttcaactagccgcagcagtgctttctgaggtaaatatcataatgttattggagcagatatattgacctaatggaaaaac |
11849277 |
T |
|
| Q |
111 |
attttatgtcttcatattttgttacacccgtatcttatgatgacaaacaccagtaaatgattatgtttgtctgtcatcgtgattgaaactttaggttaca |
210 |
Q |
| |
|
|||||||||| |||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| ||| |
|
|
| T |
11849278 |
attttatgtca--atattttgttacacccttctcttatgatgacaaacaccagtaaatgattatgtttgtctatcgtcgtgattgaaactttaggtcaca |
11849375 |
T |
|
| Q |
211 |
atagctcttgccaaaaatctgcttgttttctctgcattgtatgattgatttactcaaatttctggccaaattttcttagaaattg |
295 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |||||||| || |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11849376 |
atggctcttgccaaaaatctgcttgttttctccgcattgta----tgtattactcaagtttctggccaaattttcttagaaattg |
11849456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University