View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10638_low_20 (Length: 258)
Name: NF10638_low_20
Description: NF10638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10638_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 6 - 188
Target Start/End: Complemental strand, 2745751 - 2745576
Alignment:
| Q |
6 |
agaagcagagaggagattggaagaatgcatgaaagacaaggtactttgaacattctagtattaaaagattaaaatctgtaaggtccatttcacgattcac |
105 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2745751 |
agaagcattgaggagattggaagaatgcatgaaagacaaggtactttgaacattctagtattaaaagattaaaatctgtaaggtccatttcacga----- |
2745657 |
T |
|
| Q |
106 |
gaatccaattcatcagtgtttacatataaaattgatgtttcttgctgaaagatcaactgcttgtaatataacatactacactg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2745656 |
--atccaattcatcagtgtttacatataaaattgatgtttcttgctgaaagatcaactgcttgtaatataacatactacactg |
2745576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University