View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10638_low_21 (Length: 255)
Name: NF10638_low_21
Description: NF10638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10638_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 16700503 - 16700751
Alignment:
| Q |
1 |
ttagtgcaaacaaaaattcttaagtaactttgttcaataatccacaagttttacataaccatcatattaatatcacataatccaacaaaatat--tataa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16700503 |
ttagtgcaaacaaaaattcttaagtaactttgttcaataatccaaaagttttacataaccatcatattaatatcacataatccaacaaaatatattataa |
16700602 |
T |
 |
| Q |
99 |
acaaactattaattagtgtagggttatgcaacaaaatgaacatatcatatgaatataatctatgatacattttattccctaatctcaactttttaaaggc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16700603 |
acaaactattaattagtgtagggttatgcaacaaaatgaacatatcatatgaatataatatatgatacattttattccctaatctcaactttttaaaggc |
16700702 |
T |
 |
| Q |
199 |
attatctcaaacttaaaccaattccannnnnnnatgttcttttcatctc |
247 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16700703 |
attatctcaaacttaaaccaattccatttttttatgttcttttcatctc |
16700751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University