View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10638_low_24 (Length: 250)
Name: NF10638_low_24
Description: NF10638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10638_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 9629758 - 9629527
Alignment:
| Q |
1 |
ctctactgatcatttctgaaacaccagggatgtatatcataacatcattctggcattgtatgtatttggtgaaaaaatcaatgtatggtccaatattgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9629758 |
ctctactgatcatttctgaaacaccagggatgtatatcataacatcattctggcattgtatgtatttggtgaaaaaatgaatgtatggtccaatattgtt |
9629659 |
T |
 |
| Q |
101 |
tatttaattcatagcagctaatgattgagtatgcatgtatcatgtgtgttaatgttatttatgttttcaatttcggtccattaataattaattatatttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9629658 |
tatttaattcatagcagctaatgattgagtatgcatgtatcatgtgtgttaatgttatttatgttttcaattttggtccattaataattaattatatttt |
9629559 |
T |
 |
| Q |
201 |
cttaaaatttctcttatgtagattggaattga |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9629558 |
cttaaaatttctcttatgtagattggaattga |
9629527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University