View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10638_low_35 (Length: 218)
Name: NF10638_low_35
Description: NF10638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10638_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 17 - 192
Target Start/End: Original strand, 43006600 - 43006775
Alignment:
| Q |
17 |
agatataaaaataagataaagaagaacgcacaccacaccaagttcatccaaaactgatctgttttttctagtctcatgccttgaacaagagacccgacga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43006600 |
agatataaaaataagataaagaagaacgcacaccacacccagttcatctaaaattgatctgttttttctagtctcatgccttgaacaagagacccgacga |
43006699 |
T |
 |
| Q |
117 |
ttttattactcaaggtgttttccaacttaataatctattccagaatgaactatagttcaccacattcccacctcat |
192 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43006700 |
ttttattactcaaggtgttttccaacctaataatctattccagaatgaactatagttcaccgcattcccacctcat |
43006775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University