View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10638_low_36 (Length: 216)
Name: NF10638_low_36
Description: NF10638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10638_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 209
Target Start/End: Original strand, 19547065 - 19547258
Alignment:
| Q |
16 |
aaaaattacttgccttatttgtgggtgtctaaaacccaataaagaatgtaatctcaactcagggaatatccaaatatgggttaattaatttatgtgtaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19547065 |
aaaaattacttgccttatttgtgggtgtctaaaacccaataaagaatgtaatctcaactcagggaatatccaaatatgggttaattagtttatgtgtaaa |
19547164 |
T |
 |
| Q |
116 |
tacattttttaaaccaaagcttgtactctctaagatgcatatggatttttaagtacacttgcagaaacccaataaaacagtgaatccccctttg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19547165 |
tacattttttaaaccaaagcttgtactctctaagatgcatatggatttttaagtaaacttgcagaaacccaataaaacagtgaatccccctttg |
19547258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University