View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10638_low_37 (Length: 215)
Name: NF10638_low_37
Description: NF10638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10638_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 33 - 94
Target Start/End: Complemental strand, 9317219 - 9317158
Alignment:
| Q |
33 |
gcatgattccttgtttctatcaatggaagctctgaaatgaatctcttcttcaccagatcttg |
94 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9317219 |
gcatgattcctcgtttctatcaatggaagctctgaaatgaatctcttcttcaccagatcttg |
9317158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 158 - 206
Target Start/End: Complemental strand, 9317091 - 9317043
Alignment:
| Q |
158 |
gaacccgatcttcttcacaaacactcgtaattggtgagttcttctctct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9317091 |
gaacccgatcttcttcacaaacactcgtaattggtgagttcttcactct |
9317043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University