View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10638_low_41 (Length: 205)
Name: NF10638_low_41
Description: NF10638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10638_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 24 - 131
Target Start/End: Complemental strand, 6414246 - 6414139
Alignment:
| Q |
24 |
agagagagggaaagggttcaaaggtacgaagctagagtaaggctttaaaccctttaacagttcacgaggaagatgaaaggtagaaatgtctttggttcaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6414246 |
agagagagggaaagggttcaaaggtacgaagctagagtaaggctttaaaccctttaacagttcacgaggaagatgaaaggtagaaatgtctttggttcaa |
6414147 |
T |
|
| Q |
124 |
aacagtac |
131 |
Q |
| |
|
|||||||| |
|
|
| T |
6414146 |
aacagtac |
6414139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 107
Target Start/End: Complemental strand, 6419585 - 6419541
Alignment:
| Q |
64 |
ggctttaaacccttt-aacagttcacgaggaagatgaaaggtaga |
107 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||| |||||| |
|
|
| T |
6419585 |
ggctttaaacccttttaacggttcacgaggaagatgaatggtaga |
6419541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University