View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10639_low_23 (Length: 263)
Name: NF10639_low_23
Description: NF10639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10639_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 12511042 - 12511286
Alignment:
| Q |
1 |
ttaatggatttatgatttttcgtgtatattgccaagatgatgattatctcagtgtaatgcagttggatgcatgtttttgtttcttaatagattatacgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12511042 |
ttaatggatttatgatttttcgtgtatattgccaagatgatgattatctcagtgtaatgcagttggatgcatgtttttgtttcttaatagattatacgat |
12511141 |
T |
|
| Q |
101 |
aataacatttaaaaattcgtaaacataagtggaggagttcaaatacgaaccatttttgtcggttgaaataagacttatcaaacnnnnnnnngttggtaat |
200 |
Q |
| |
|
|||||| ||||||| || ||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
12511142 |
aataacgcttaaaaactcataaacataaatggaggagtttaaatacggaccatttttgtcggttgaaataagacttatcaattttttttttgttagtaat |
12511241 |
T |
|
| Q |
201 |
gcaaatggatataagtatatactatgattttaactattccttacc |
245 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12511242 |
gcaaatggatataagtgtatactatgattttaactattccttacc |
12511286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University