View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10639_low_30 (Length: 242)
Name: NF10639_low_30
Description: NF10639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10639_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 52 - 224
Target Start/End: Complemental strand, 40453122 - 40452949
Alignment:
| Q |
52 |
tatctctatttgtatgtgggtaaaagtcccctctgaatagtcggagatggcactggatcatgcaatcctcattccttattactctgcataggtggctatg |
151 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40453122 |
tatctctatttatatgtgggtagaagtcccctctaaattgtcggagatggcactggatcatgcagtcctcattccttattactctgcataggtggctatg |
40453023 |
T |
|
| Q |
152 |
tgtttgaaaaatttgaatgttcaactaacaaatcgaaattccctcaacaa-caaaaaagactaacgaatcgaaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
40453022 |
tgtttgaaaaatttgaatgttcaactaacaaatcgaaattccctcaacaaccaaaaaaaactaaccaatcgaaa |
40452949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 40453158 - 40453122
Alignment:
| Q |
1 |
tattttactgtcatttatacgttgtccgtgggtaaat |
37 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
40453158 |
tattttactgtcatttatacattgtccgtaggtaaat |
40453122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University