View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10639_low_38 (Length: 229)
Name: NF10639_low_38
Description: NF10639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10639_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 15 - 210
Target Start/End: Original strand, 298821 - 299016
Alignment:
| Q |
15 |
tgaaccaaacgggcacctcatctaactattatgatgccatctaatgataaaatgtatgcagttaggtttgtttactcttcaatatttgctgcccattaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
298821 |
tgaaccaaacgggcacctcatctaactattatgatgccatctaatgataaaatgtatgcagttaggtttgtttactcttcaatatttgctgcccattaga |
298920 |
T |
|
| Q |
115 |
tgcagaccaagtgttccaactaaattttcaaatttcccccttcacgtgggagaggaaaggagtccttttgctgcaaagggctagtttggggggaac |
210 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
298921 |
tgcagactaagtgttccaactaaattttcaaatttcccccttcacgtgggagaggaaaggagtccttttgctgcaaagggctagtttggggggaac |
299016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University