View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10639_low_41 (Length: 216)
Name: NF10639_low_41
Description: NF10639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10639_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 111 - 199
Target Start/End: Original strand, 15262570 - 15262658
Alignment:
| Q |
111 |
taccatggcatcctcaaattcaccatgtgcagcatgcaagtttctacgccgaaaatgtcaaccagaatgtgcatttgcaccttattttc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15262570 |
taccatggcatcctcaaattcaccatgtgcagcatgcaagtttctacgccgaaaatgccaaccagaatgtgcatttgcaccttattttc |
15262658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 155
Target Start/End: Original strand, 19281994 - 19282025
Alignment:
| Q |
124 |
tcaaattcaccatgtgcagcatgcaagtttct |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19281994 |
tcaaattcaccatgtgcagcatgcaagtttct |
19282025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University