View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10639_low_41 (Length: 216)

Name: NF10639_low_41
Description: NF10639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10639_low_41
NF10639_low_41
[»] chr8 (1 HSPs)
chr8 (111-199)||(15262570-15262658)
[»] chr3 (1 HSPs)
chr3 (124-155)||(19281994-19282025)


Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 111 - 199
Target Start/End: Original strand, 15262570 - 15262658
Alignment:
111 taccatggcatcctcaaattcaccatgtgcagcatgcaagtttctacgccgaaaatgtcaaccagaatgtgcatttgcaccttattttc 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
15262570 taccatggcatcctcaaattcaccatgtgcagcatgcaagtttctacgccgaaaatgccaaccagaatgtgcatttgcaccttattttc 15262658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 155
Target Start/End: Original strand, 19281994 - 19282025
Alignment:
124 tcaaattcaccatgtgcagcatgcaagtttct 155  Q
    ||||||||||||||||||||||||||||||||    
19281994 tcaaattcaccatgtgcagcatgcaagtttct 19282025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University