View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10639_low_42 (Length: 207)
Name: NF10639_low_42
Description: NF10639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10639_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 92 - 191
Target Start/End: Complemental strand, 27800589 - 27800491
Alignment:
| Q |
92 |
gcaactaattgattagttgaatggttacaattgcaatgcatagccatttcaatatacacaaactatccaacaatagaatcccttgtaattataacttctt |
191 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27800589 |
gcaactaattgattagttgaatagt-acaattgcaatgcatagccattgcaatatacacaaactatcaaacaatagaatcccttgtaattataacttctt |
27800491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 49
Target Start/End: Complemental strand, 27800618 - 27800590
Alignment:
| Q |
21 |
ataggcaacgcataatgaacttgtctttg |
49 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27800618 |
ataggcaacgcataatgaacttgtctttg |
27800590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University