View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10639_low_42 (Length: 207)

Name: NF10639_low_42
Description: NF10639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10639_low_42
NF10639_low_42
[»] chr7 (2 HSPs)
chr7 (92-191)||(27800491-27800589)
chr7 (21-49)||(27800590-27800618)


Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 92 - 191
Target Start/End: Complemental strand, 27800589 - 27800491
Alignment:
92 gcaactaattgattagttgaatggttacaattgcaatgcatagccatttcaatatacacaaactatccaacaatagaatcccttgtaattataacttctt 191  Q
    |||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||    
27800589 gcaactaattgattagttgaatagt-acaattgcaatgcatagccattgcaatatacacaaactatcaaacaatagaatcccttgtaattataacttctt 27800491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 49
Target Start/End: Complemental strand, 27800618 - 27800590
Alignment:
21 ataggcaacgcataatgaacttgtctttg 49  Q
    |||||||||||||||||||||||||||||    
27800618 ataggcaacgcataatgaacttgtctttg 27800590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University