View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10639_low_8 (Length: 417)
Name: NF10639_low_8
Description: NF10639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10639_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 4e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 180 - 402
Target Start/End: Complemental strand, 9605356 - 9605135
Alignment:
| Q |
180 |
aataatttttacttttgaatatttcaagagttcttcgaagacatttgttagtgaaattcaaataaaatttacatgtagtgtggagctgtattgatgctaa |
279 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||| || || ||||||||||||||||||||||||||| ||||||||| | |||||||||| |
|
|
| T |
9605356 |
aataattttcacttttgaatatttaaagagttcttcgaagactttcgtcagtgaaattcaaataaaatttacatgtgatgtggagctctgttgatgctaa |
9605257 |
T |
|
| Q |
280 |
catgcaaaaatcattattgattcttcttcatttatataggctatctttgagtcattatataccaaagttgattgtattgattgcatatgcctagcattat |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9605256 |
catgcaaaaatcattattgattcttcttcatttatataggctatctttgagtca-tatataccaaagttgtttgtattgattgcatatgcctagcattat |
9605158 |
T |
|
| Q |
380 |
atagcccacgtactcaagttttt |
402 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9605157 |
atagcccacgtactcaagttttt |
9605135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University