View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1063_low_33 (Length: 321)
Name: NF1063_low_33
Description: NF1063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1063_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 187
Target Start/End: Original strand, 3909359 - 3909414
Alignment:
| Q |
132 |
atctgcttctttggctctaaatcaatggcatgatctgtcagagttcaatcctcctc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3909359 |
atctgcttctttggctctaaatcaatggcatgatctgtcagagttcaatcctcctc |
3909414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 3909323 - 3909373
Alignment:
| Q |
271 |
tggtggtaatggaagtgctggtcctggtgctagtggatctgcttctttggc |
321 |
Q |
| |
|
|||||||||||| |||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
3909323 |
tggtggtaatggtagtgttggtgctggggctagtggatctgcttctttggc |
3909373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University