View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1063_low_37 (Length: 307)
Name: NF1063_low_37
Description: NF1063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1063_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 29 - 300
Target Start/End: Complemental strand, 28399360 - 28399086
Alignment:
| Q |
29 |
aatatgtatagattccgattgattaata---tattggtatttttatgatggatttgtctttgattattctttcacttatgtatctatgtttcttagtata |
125 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28399360 |
aatatgtatagattccgattgattaataatatattggtatttttatgatagatttgtctctgattattcttgcacttatgtatctatgtttcttagtata |
28399261 |
T |
|
| Q |
126 |
tctgtttgttttaaaaactgttgagtacttttccttttaggggaaaaactgtttagcaaactgtttgnnnnnnnnncctcttgtctagtgttcttaatta |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28399260 |
tctgtttgttttaaaaactgttgagtacttttctttttaggggaaaaactgtttagcaaactgtttgtttcttttccctcttgtctagtgttcttaatta |
28399161 |
T |
|
| Q |
226 |
ggcatcattaatgaatataatagtataacaagttactcataaatatgaatacatcaaggtttatgagaataatct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28399160 |
ggcatcattaatgaatataatagtataacaagttactcataaatatgaatacatcaaggtttatgagagtaatct |
28399086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University