View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1063_low_42 (Length: 292)
Name: NF1063_low_42
Description: NF1063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1063_low_42 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 292
Target Start/End: Complemental strand, 34408451 - 34408174
Alignment:
| Q |
16 |
atcaagtacgagactgagattttatttttcagcccaacaaaatcaagcacgggtacgagaatgctcgaactcgttgggttcaggatcgnnnnnnnnnnnn |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34408451 |
atcaagtatgagactgagattttatttttcagcccaacgaaatcaaggacgggtacgagaatgctcgaactcgttgggttcaggaacgaaaaaggaaaaa |
34408352 |
T |
|
| Q |
116 |
ngtatctttgcccctgttgtcatgcctactaagcgcctgatggacagcctgaaccttgtactgttgcagttttatcatgtttttagattgcaatggttat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34408351 |
agtatctttgcccctgttgtcatgcctactaagtgcctgatggacagcctgaaccttgtactgttgcagttttatcatgtttttagattgcaatggttat |
34408252 |
T |
|
| Q |
216 |
gtctcttcatatacttgattaagagatgtagtttcattgtcatta-tggattaaaagtgaacaaacgcaactcttgat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
34408251 |
gtctcttcatatacttgattaagagatgtagtttcattgtcattactggattaaaagtgaacaaacacaactcttgat |
34408174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University