View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1063_low_45 (Length: 266)
Name: NF1063_low_45
Description: NF1063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1063_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 36 - 174
Target Start/End: Complemental strand, 39678599 - 39678461
Alignment:
| Q |
36 |
aaaataaactaagcatgcactttctgtatttgatgcactggtttgcttttttgatcatgaactgatttattctcaaggtgtatagaggaccttcagataa |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39678599 |
aaaataaactaagcatgcactttctgtattcgatgcactggtttgcttttttgatcatgaactgatttattctcaaggtgtatagaggaccttcagataa |
39678500 |
T |
 |
| Q |
136 |
ccacggtgtgctgcagaaatcgaatcaaatccctatttg |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39678499 |
ccacggtgtgctgcagaaatcgaatcaaatccctatttg |
39678461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University