View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1063_low_53 (Length: 219)
Name: NF1063_low_53
Description: NF1063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1063_low_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 35 - 169
Target Start/End: Original strand, 19276917 - 19277053
Alignment:
| Q |
35 |
cacataatcaatcaaaatccaaatcacctcaacaaaaggttttgttaatttaatataaacaactactagtactattatttgtttgtcactgttgtttagt |
134 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19276917 |
cacagaatcaatcaaaagccaaatcacctcaacaaaaggttttgttaatttaatgtaaacaactactagtactattatttgtttgtcactgttgtttagt |
19277016 |
T |
|
| Q |
135 |
taa--tctctctctctttttgtctcctaaaccaagac |
169 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19277017 |
taatctctctctctctttttgtctcctaaaccaagac |
19277053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University