View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10640_high_7 (Length: 243)
Name: NF10640_high_7
Description: NF10640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10640_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 72 - 225
Target Start/End: Original strand, 26436364 - 26436517
Alignment:
| Q |
72 |
agagatgaaatgtatatttggtttggtgtttcctccacattgatgtttgtcaatctgggttttcgatatgaagggacgtgggcacgatacactgttaggt |
171 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26436364 |
agagatgaaaagtatatttggtttggtgtttactccatattgatgtttgtcaatctgggttttcgatatgaagggacgtgggcacgatgcactgttaggt |
26436463 |
T |
 |
| Q |
172 |
gttgtaccatctgttttgaattcctaattcccaactctagtgtaggaatgtggt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26436464 |
gttgtaccatctgttttgaattcctaattcccaactctagtgtaggaatgtggt |
26436517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 26436291 - 26436325
Alignment:
| Q |
1 |
ccaagattcaatatctttgtactatttgaatattg |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
26436291 |
ccaagattcaatatctttgtactatttgaatattg |
26436325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University