View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10640_high_8 (Length: 243)
Name: NF10640_high_8
Description: NF10640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10640_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 4504095 - 4504302
Alignment:
| Q |
1 |
tcaaaaaagtgagagagattaatcacgagatctgagctagggctaatgttcatgggaccatttttgttggaacataatgtattgtcatgtgtatgttagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4504095 |
tcaaaaaagtgagagagattaatcacgagatctgagctagggcttatgttcatgggaccatttttgttggaccataatgtattgtcatgtgtatgttagt |
4504194 |
T |
|
| Q |
101 |
tacccttatggccccacaacacaagcagttaattggtcaa-ttttcagataatgtctttagagattccattcagtagagtctcttcccttagttgcaact |
199 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4504195 |
tacccttatggccccataacacaagcagttaattggtcaatttttcagataatgtctttagagattccattcagtagagtctcttcccttagttgcaact |
4504294 |
T |
|
| Q |
200 |
tttcttta |
207 |
Q |
| |
|
|||||||| |
|
|
| T |
4504295 |
tttcttta |
4504302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University