View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10640_low_14 (Length: 273)
Name: NF10640_low_14
Description: NF10640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10640_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 10 - 259
Target Start/End: Original strand, 35688431 - 35688680
Alignment:
| Q |
10 |
gcagagaattctgatcaggttctttgatttttctttatttatatgatgataaggtgcaaacaacaacataaaatatagtactacttcattaattatgtag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35688431 |
gcagagaattctgatcaggttctttgatttttctttatttatatgatgataaggtgcaaacaacaacataaaatatagtactacttcattaattatgtag |
35688530 |
T |
|
| Q |
110 |
agagaggaagagatagaatgaatacattggtgttcactgaactggtgaatttgcattcagtttcaatatcagctatgtggtagttcgagatctccaacat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35688531 |
agagaggaagagatagaatgaatacattggtgttcactgaactggtgaatttgcattcagtttcaatatcagctatgtggtagttcgagatctccaacat |
35688630 |
T |
|
| Q |
210 |
gaacaaagttgatgcatctgatttggtaaaaaatcattggccatgcatgt |
259 |
Q |
| |
|
| ||||||||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
35688631 |
ggacaaagttgttgcatctgatttggtaaaagatcattggccatgtatgt |
35688680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University