View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10640_low_20 (Length: 243)

Name: NF10640_low_20
Description: NF10640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10640_low_20
NF10640_low_20
[»] chr7 (1 HSPs)
chr7 (1-207)||(4504095-4504302)


Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 4504095 - 4504302
Alignment:
1 tcaaaaaagtgagagagattaatcacgagatctgagctagggctaatgttcatgggaccatttttgttggaacataatgtattgtcatgtgtatgttagt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
4504095 tcaaaaaagtgagagagattaatcacgagatctgagctagggcttatgttcatgggaccatttttgttggaccataatgtattgtcatgtgtatgttagt 4504194  T
101 tacccttatggccccacaacacaagcagttaattggtcaa-ttttcagataatgtctttagagattccattcagtagagtctcttcccttagttgcaact 199  Q
    |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4504195 tacccttatggccccataacacaagcagttaattggtcaatttttcagataatgtctttagagattccattcagtagagtctcttcccttagttgcaact 4504294  T
200 tttcttta 207  Q
    ||||||||    
4504295 tttcttta 4504302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University