View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10640_low_21 (Length: 243)
Name: NF10640_low_21
Description: NF10640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10640_low_21 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 116 - 243
Target Start/End: Complemental strand, 4163830 - 4163693
Alignment:
| Q |
116 |
gacgcaattactgcatcaaatccaaatcgaatt----------ataagaaactcactctaaggtatggtttctaggtgttctttatacttaccacaatag |
205 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4163830 |
gacgcagttactgcatcaaatccaaatcgaattataaaaaattataagaaactcactctgaggtatggtttctaggtgttctttatacttaccacattag |
4163731 |
T |
|
| Q |
206 |
gccaaatattgagggcacatgctgccaaagaatttagc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4163730 |
gccaaatattgagggcacatgctgccaaagaatttagc |
4163693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University